Stem-loop sequence hsa-mir-3677

Accession MI0016078
Description Homo sapiens miR-3677 stem-loop
Stem-loop 
   a             ------u  -a      
ggc guggccagagccc       gc  gugcu 
||| |||||||||||||       ||  |||| g
ccg caccggucucggg       cg  uacgg 
   g             ugcucuu  gg
Get sequence
Deep sequencing
60 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 2320714-2320773 [+]
sense
OTTHUMT00000435436 ; RP11-304L19.13-002; intron 1
OTTHUMT00000435437 ; RP11-304L19.13-003; intron 1
OTTHUMT00000435438 ; RP11-304L19.13-001; intron 1
OTTHUMT00000435436 ; RP11-304L19.13-002; intron 1
OTTHUMT00000435437 ; RP11-304L19.13-003; intron 1
OTTHUMT00000435438 ; RP11-304L19.13-001; intron 1
ENST00000563734 ; RP11-304L19.13-002; intron 1
ENST00000567888 ; RP11-304L19.13-003; intron 1
ENST00000562838 ; RP11-304L19.13-001; intron 1
ENST00000563734 ; hsa-mir-940.1-002; intron 1
ENST00000567888 ; hsa-mir-940.1-003; intron 1
ENST00000562838 ; hsa-mir-940.1-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-3677
hsa-mir-3677 chr16: 2320714-2320773 [+]
hsa-mir-940 chr16: 2321748-2321841 [+]
hsa-mir-4717 chr16: 2324621-2324692 [+]
Database links

Mature sequence hsa-miR-3677-5p

Accession MIMAT0019221
Sequence

3 -  

caguggccagagcccugcagug

 - 24

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-3677-3p

Accession MIMAT0018101
Previous IDs hsa-miR-3677
Sequence

39 -  

cucgugggcucuggccacggcc

 - 60

Get sequence
Deep sequencing 59 reads, 8 experiments
Evidence experimental; Solexa [1-2]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).