|
miRBase |
|
Stem-loop sequence hsa-mir-3674 |
|||||
| Accession | MI0016075 | ||||
| Description | Homo sapiens miR-3674 stem-loop | ||||
| Stem-loop |
cu u c aa uu c acauca a uguagaa cu ga gg cguuu |||||| | ||||||| || || || |||| g uguagu u acguuuu ga cu cc guaga cu u u -a uu u |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3674 |
|
| Accession | MIMAT0018097 |
| Sequence |
9 - auuguagaaccuaagauuggcc - 30 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20459673
"Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
BMC Genomics. 11:288(2010).
|