|
miRBase |
|
Stem-loop sequence hsa-mir-3666 |
|||||
| Accession | MI0016067 | ||||
| Description | Homo sapiens miR-3666 stem-loop | ||||
| Stem-loop |
aguaa --cg --u a - c u a - -c cg gguc ucagu gu au gagacc ag gca gugu agaugc gacuc u |||| ||||| || || |||||| || ||| |||| |||||| ||||| g uuag aguua ca ug cucugg uc cgu caca uuugcg uugag g ----g auua ucu c u - - - c ac ac |
||||
| Comments |
This sequence was predicted as a miRNA by Xie et al. [1] and validated later by microarray [2]. |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3666 |
|
| Accession | MIMAT0018088 |
| Sequence |
29 - cagugcaaguguagaugccga - 49 |
| Evidence | experimental; microarray [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|
| 2 |
PMID:20559549
"Large-scale expression analysis reveals distinct microRNA profiles at different stages of human neurodevelopment"
PLoS One. 5:e11109(2010).
|