Stem-loop sequence hsa-mir-3664

Accession MI0016065
Description Homo sapiens miR-3664 stem-loop
Gene family MIPF0001518; mir-3664
Stem-loop 
cuguaa  -                       c    a    uac   cc 
      ac uugaagguagggaacucugucuu acuc ugag   cuu  a
      || ||||||||||||||||||||||| |||| ||||   |||  a
      ug aacuuccaucccuugagacagaa ugag acuc   gag  c
--uagg  u                       a    g    -uc   ca
Get sequence
Deep sequencing
2 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 70718375-70718473 [-]
sense
OTTHUMT00000259333 ; SHANK2-005; intron 1
OTTHUMT00000327653 ; SHANK2-018; intron 1
OTTHUMT00000259333 ; SHANK2-005; intron 1
OTTHUMT00000327653 ; SHANK2-018; intron 1
OTTHUMT00000259333 ; SHANK2-005; intron 1
OTTHUMT00000327653 ; SHANK2-018; intron 1
OTTHUMT00000327649 ; SHANK2-014; intron 2
OTTHUMT00000327649 ; SHANK2-014; intron 2
OTTHUMT00000327649 ; SHANK2-014; intron 2
ENST00000294018 ; SHANK2-005; intron 1
ENST00000425049 ; SHANK2-018; intron 1
ENST00000294018 ; SHANK2-005; intron 1
ENST00000425049 ; SHANK2-018; intron 1
ENST00000294018 ; SHANK2-005; intron 1
ENST00000425049 ; SHANK2-018; intron 1
ENST00000460048 ; SHANK2-014; intron 2
ENST00000460048 ; SHANK2-014; intron 2
ENST00000460048 ; SHANK2-014; intron 2
ENST00000338508 ; SHANK2-201; intron 17
ENST00000338508 ; SHANK2-201; intron 17
ENST00000338508 ; SHANK2-201; intron 17
Database links

Mature sequence hsa-miR-3664-5p

Accession MIMAT0018086
Previous IDs hsa-miR-3664
Sequence

21 -  

aacucugucuucacucaugagu

 - 42

Get sequence
Evidence experimental; Northern [1], Solexa [2]
Predicted targets

Mature sequence hsa-miR-3664-3p

Accession MIMAT0019220
Sequence

59 -  

ucucaggaguaaagacagaguu

 - 80

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).