Stem-loop sequence hsa-mir-3661

Accession

MI0016062

Description

Homo sapiens miR-3661 stem-loop

Gene family

MIPF0001530; mir-3661

Stem-loop

caccuuc    a    cu  u    -ug   c   ga      cuu  a 
       ucgc gagg  cu gacc   gga ucg  cagcug   gc c
       |||| ||||  || ||||   ||| |||  ||||||   ||  
       agug uucc  ga cugg   ccu agc  gucgac   ug u
uuccaca    g    uc  c    uca   -   uc      --u  c 

Deep sequencing

9 reads, 5 experiments

Genome context

• Coordinates (GRCh37.p5): chr5: 133561448-133561543 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000381445 ; SKP1-014; intron 1

  OTTHUMT00000251165 ; PPP2CA-001; intron 1

  OTTHUMT00000381591 ; PPP2CA-007; intron 1

  OTTHUMT00000381445 ; SKP1-014; intron 1

  OTTHUMT00000251165 ; PPP2CA-001; intron 1

  OTTHUMT00000381591 ; PPP2CA-007; intron 1

  OTTHUMT00000381445 ; SKP1-014; intron 1

  OTTHUMT00000251165 ; PPP2CA-001; intron 1

  OTTHUMT00000381591 ; PPP2CA-007; intron 1

  OTTHUMT00000377694 ; CDKL3-005; intron 6

  OTTHUMT00000377694 ; CDKL3-005; intron 6

  OTTHUMT00000377694 ; CDKL3-005; intron 6

  OTTHUMT00000377693 ; CDKL3-004; intron 9

  OTTHUMT00000377693 ; CDKL3-004; intron 9

  OTTHUMT00000377693 ; CDKL3-004; intron 9

  ENST00000519718 ; SKP1-014; intron 1

  ENST00000481195 ; PPP2CA-001; intron 1

  ENST00000231504 ; PPP2CA-007; intron 1

  ENST00000519718 ; SKP1-014; intron 1

  ENST00000481195 ; PPP2CA-001; intron 1

  ENST00000231504 ; PPP2CA-007; intron 1

  ENST00000519718 ; SKP1-014; intron 1

  ENST00000481195 ; PPP2CA-001; intron 1

  ENST00000231504 ; PPP2CA-007; intron 1

  ENST00000518409 ; CDKL3-005; intron 6

  ENST00000518409 ; CDKL3-005; intron 6

  ENST00000518409 ; CDKL3-005; intron 6

  ENST00000520515 ; CDKL3-004; intron 9

  ENST00000520515 ; CDKL3-004; intron 9

  ENST00000520515 ; CDKL3-004; intron 9

Database links

• ENTREZGENE: 100500905;MIR3661

Mature sequence hsa-miR-3661

• Accession: MIMAT0018082
• Sequence: 21 - ugaccugggacucggacagcug - 42
• Deep sequencing: 7 reads, 3 experiments
• Evidence: experimental; Northern [1], Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3661
  • MIRDB:hsa-miR-3661
  • RNA22-HSA:hsa-miR-3661
  • TARGETMINER:hsa-miR-3661

References

1. PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).