Stem-loop sequence hsa-mir-3659

Accession MI0016060
Description Homo sapiens miR-3659 stem-loop
Stem-loop 
uc    a                       c       a    -   cu 
  uaca gcagauacaaggaugcccuugua acaacac cgug cug  u
  |||| ||||||||||||||||||||||| ||||||| |||| |||   
  gugu ugucuguguuccuacgggagcau uguugug guac gau  g
gu    g                       c       a    a   au
Get sequence
Deep sequencing
4 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 38554903-38555001 [+]
sense
OTTHUMT00000001200 ; RP5-884C9.2-001; intron 1
OTTHUMT00000001201 ; RP5-884C9.2-002; intron 1
OTTHUMT00000001201 ; RP5-884C9.2-002; intron 1
OTTHUMT00000001200 ; RP5-884C9.2-001; intron 1
OTTHUMT00000001201 ; RP5-884C9.2-002; intron 1
OTTHUMT00000001200 ; RP5-884C9.2-001; intron 1
ENST00000428151 ; RP5-884C9.2-001; intron 1
ENST00000432922 ; RP5-884C9.2-002; intron 1
ENST00000432922 ; RP5-884C9.2-002; intron 1
ENST00000428151 ; RP5-884C9.2-001; intron 1
ENST00000432922 ; RP5-884C9.2-002; intron 1
ENST00000428151 ; RP5-884C9.2-001; intron 1
Database links

Mature sequence hsa-miR-3659

Accession MIMAT0018080
Sequence

59 -  

ugaguguugucuacgagggca

 - 79

Get sequence
Deep sequencing 4 reads, 1 experiments
Evidence experimental; Northern [1], Solexa [2]
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).