Dead miRNA entry

miRNA accession:
MI0016059
miRNA ID:
hsa-mir-1273e
Comment:
Many of the miRNA loci annotated as mir-1273 family members have patterns of mapped reads from RNAseq experiments that are not consistent with the gene being processed as a miRNA. The reads may be derived from SRP RNA, or derived Alu repeats. hsa-mir-1273a,b,d,e,f,g are removed the database.

Previous miRNA entry

Stem-loop sequence hsa-mir-1273e

AccessionMI0016059 (change log)
Symbol HGNC:MIR1273E
DescriptionHomo sapiens miR-1273e stem-loop
Gene family MIPF0000579; mir-1273
Stem-loop
   u     a    aa     -  -a       aag     gc       a  -  a 
5'  gaggc ggag  uugcu ug  acccagg   uggag  ugcagug gc cg g
    ||||| ||||  ||||| ||  |||||||   |||||  ||||||| || ||  
3'  cucug ccuc  agcga ac  ugggucc   accuc  augucac cg gc a
   a     a    ag     c  ag       --g     --       -  a  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1273e

Accession MIMAT0018079
Sequence

14 - 

uugcuugaacccaggaagugga

 - 35

Get sequence
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).