Stem-loop sequence hsa-mir-1273e

AccessionMI0016059
DescriptionHomo sapiens miR-1273e stem-loop
Gene family MIPF0000579; mir-1273
Stem-loop
   u     a    aa     -  -a       aag     gc       a  -  a 
5'  gaggc ggag  uugcu ug  acccagg   uggag  ugcagug gc cg g
    ||||| ||||  ||||| ||  |||||||   |||||  ||||||| || ||  
3'  cucug ccuc  agcga ac  ugggucc   accuc  augucac cg gc a
   a     a    ag     c  ag       --g     --       -  a  u 
Get sequence
Deep sequencing
2134 reads, 1.22e+03 reads per million, 74 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 64425069-64425170 [-]
antisense
OTTHUMT00000446950 ; PRKCA-001; intron 2
OTTHUMT00000446976 ; PRKCA-002; intron 2
OTTHUMT00000446977 ; PRKCA-003; intron 2
ENST00000578063 ; PRKCA-001; intron 2
ENST00000413366 ; PRKCA-002; intron 2
ENST00000284384 ; PRKCA-003; intron 2
Database links

Mature sequence hsa-miR-1273e

Accession MIMAT0018079
Sequence

14 - 

uugcuugaacccaggaagugga

 - 35

Get sequence
Deep sequencing25 reads, 15 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).