Stem-loop sequence hsa-mir-3658

AccessionMI0016058
Symbol HGNC:MIR3658
DescriptionHomo sapiens miR-3658 stem-loop
Stem-loop
      -uu       caccau      g   u 
5' uau   aagaaaa      ggagau aaa g
   |||   |||||||      |||||| |||  
3' aug   uucuuuu      uuuuua uuu c
      uuu       -----u      g   c 
Get sequence
Deep sequencing
6 reads, 71 reads per million, 53 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 165907921-165907976 [+]
intergenic
Database links

Mature sequence hsa-miR-3658

Accession MIMAT0018078
Sequence

3 - 

uuuaagaaaacaccauggagau

 - 24

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).