Stem-loop sequence hsa-mir-3657

Accession

MI0016057

Description

Homo sapiens miR-3657 stem-loop

Stem-loop

       ca      a   a                              --      g 
ugugucc  uaauua aua ugaaaucugaaaucaccaauaaugggacac  uaaugu a
|||||||  |||||| ||| ||||||||||||||||||||||||||||||  |||||| u
auacagg  auuagu uau acuuuagacuuuagugguuauuacccugug  guugua u
       -a      a   -                              uu      a 

Genome context

• Coordinates (GRCh37.p5): chr12: 112475403-112475519 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000405206 ; NAA25-004; intron 21

  OTTHUMT00000405206 ; NAA25-004; intron 21

  OTTHUMT00000405206 ; NAA25-004; intron 21

  OTTHUMT00000405205 ; NAA25-001; intron 22

  OTTHUMT00000405208 ; NAA25-003; intron 22

  OTTHUMT00000405205 ; NAA25-001; intron 22

  OTTHUMT00000405208 ; NAA25-003; intron 22

  OTTHUMT00000405205 ; NAA25-001; intron 22

  OTTHUMT00000405208 ; NAA25-003; intron 22

  ENST00000552527 ; NAA25-004; intron 21

  ENST00000552527 ; NAA25-004; intron 21

  ENST00000552527 ; NAA25-004; intron 21

  ENST00000261745 ; NAA25-001; intron 22

  ENST00000549711 ; NAA25-003; intron 22

  ENST00000261745 ; NAA25-001; intron 22

  ENST00000549711 ; NAA25-003; intron 22

  ENST00000261745 ; NAA25-001; intron 22

  ENST00000549711 ; NAA25-003; intron 22

Database links

• ENTREZGENE: 100500889;MIR3657

Mature sequence hsa-miR-3657

• Accession: MIMAT0018077
• Sequence: 69 - ugugucccauuauuggugauu - 89
• Evidence: experimental; 454 [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3657
  • MIRDB:hsa-miR-3657
  • RNA22-HSA:hsa-miR-3657
  • TARGETMINER:hsa-miR-3657

References

1. PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).