Stem-loop sequence hsa-mir-3651

Accession

MI0016051

Description

Homo sapiens miR-3651 stem-loop

Stem-loop

  u  g   gg   uagcaauccu      uau  -    a       uc 
ga uc aug  cca          gugauu   gc augg ggcugcu  u
|| || |||  |||          ||||||   || |||| |||||||  c
cu ag uac  ggu          cgcugg   cg uacc ucgacga  c
  u  -   au   ----------      -cc  a    g       cu 

Deep sequencing

1 reads, 1 experiments

Genome context

• Coordinates (GRCh37.p5): chr9: 95054740-95054829 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000053059 ; IARS-001; intron 1

  OTTHUMT00000053062 ; IARS-004; intron 1

  OTTHUMT00000053063 ; IARS-005; intron 1

  OTTHUMT00000053060 ; IARS-002; intron 1

  OTTHUMT00000053065 ; IARS-007; intron 1

  OTTHUMT00000053064 ; IARS-006; intron 1

  OTTHUMT00000053059 ; IARS-001; intron 1

  OTTHUMT00000053062 ; IARS-004; intron 1

  OTTHUMT00000053063 ; IARS-005; intron 1

  OTTHUMT00000053060 ; IARS-002; intron 1

  OTTHUMT00000053065 ; IARS-007; intron 1

  OTTHUMT00000053064 ; IARS-006; intron 1

  OTTHUMT00000053059 ; IARS-001; intron 1

  OTTHUMT00000053062 ; IARS-004; intron 1

  OTTHUMT00000053063 ; IARS-005; intron 1

  OTTHUMT00000053060 ; IARS-002; intron 1

  OTTHUMT00000053065 ; IARS-007; intron 1

  OTTHUMT00000053064 ; IARS-006; intron 1

  ENST00000451588 ; IARS-205; intron 1

  ENST00000375629 ; IARS-201; intron 1

  ENST00000395554 ; IARS-002; intron 1

  ENST00000490438 ; IARS-007; intron 1

  ENST00000430417 ; IARS-006; intron 1

  ENST00000443024 ; IARS-203; intron 1

  ENST00000447699 ; IARS-204; intron 1

  ENST00000375660 ; IARS-202; intron 1

  ENST00000375643 ; IARS-001; intron 1

  ENST00000421189 ; IARS-004; intron 1

  ENST00000436450 ; IARS-005; intron 1

  ENST00000459229 ; SNORA84-201; exon 1

  ENST00000375643 ; IARS-001; intron 1

  ENST00000421189 ; IARS-004; intron 1

  ENST00000436450 ; IARS-005; intron 1

  ENST00000395554 ; IARS-002; intron 1

  ENST00000490438 ; IARS-007; intron 1

  ENST00000430417 ; IARS-006; intron 1

  ENST00000443024 ; IARS-203; intron 1

  ENST00000447699 ; IARS-204; intron 1

  ENST00000375660 ; IARS-202; intron 1

  ENST00000451588 ; IARS-205; intron 1

  ENST00000375629 ; IARS-201; intron 1

  ENST00000459229 ; SNORA84-201; exon 1

  ENST00000375643 ; IARS-001; intron 1

  ENST00000421189 ; IARS-004; intron 1

  ENST00000436450 ; IARS-005; intron 1

  ENST00000395554 ; IARS-002; intron 1

  ENST00000490438 ; IARS-007; intron 1

  ENST00000430417 ; IARS-006; intron 1

  ENST00000443024 ; IARS-202; intron 1

  ENST00000447699 ; IARS-203; intron 1

  ENST00000375629 ; IARS-201; intron 1

  ENST00000459229 ; SNORA84-201; exon 1

Database links

• ENTREZGENE: 100500918;MIR3651

Mature sequence hsa-miR-3651

• Accession: MIMAT0018071
• Sequence: 64 - cauagcccggucgcugguacauga - 87
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; 454 [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3651
  • MIRDB:hsa-miR-3651
  • RNA22-HSA:hsa-miR-3651
  • TARGETMINER:hsa-miR-3651

References

1. PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).