Stem-loop sequence hsa-mir-3646

AccessionMI0016046 (change log)
Symbol HGNC:MIR3646
DescriptionHomo sapiens miR-3646 stem-loop
Literature search

4 open access papers mention hsa-mir-3646
(67 sentences)

Stem-loop
   u     a                      ug   ---a   u 
5'  ucagu gguuggguucauuucauuuuca  aca    ccc a
    ||||| ||||||||||||||||||||||  |||    ||| u
3'  aguua ccgacccgaguaaaguaaaagu  ugu    ggg a
   a     c                      gu   aaaa   u 
Get sequence
Deep sequencing
15 reads, 18.2 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 44408120-44408203 [+]
antisense
OTTHUMT00000079513 ; WFDC3-006; intron 1
OTTHUMT00000316864 ; WFDC3-013; intron 1
OTTHUMT00000079509 ; WFDC3-002; intron 1
OTTHUMT00000316861 ; WFDC3-010; intron 2
OTTHUMT00000316865 ; WFDC3-014; intron 2
OTTHUMT00000316860 ; WFDC3-009; intron 2
OTTHUMT00000079512 ; WFDC3-005; intron 2
OTTHUMT00000316862 ; WFDC3-011; intron 2
OTTHUMT00000079510 ; WFDC3-003; intron 3
OTTHUMT00000316859 ; WFDC3-008; intron 3
OTTHUMT00000079508 ; WFDC3-001; intron 4
OTTHUMT00000316858 ; WFDC3-007; intron 4
ENST00000474942 ; WFDC3-006; intron 1
ENST00000372630 ; WFDC3-013; intron 1
ENST00000471401 ; WFDC3-002; intron 1
ENST00000481847 ; WFDC3-010; intron 2
ENST00000372632 ; WFDC3-014; intron 2
ENST00000462017 ; WFDC3-009; intron 2
ENST00000467679 ; WFDC3-005; intron 2
ENST00000490877 ; WFDC3-011; intron 2
ENST00000493693 ; WFDC3-003; intron 3
ENST00000487343 ; WFDC3-008; intron 3
ENST00000337205 ; WFDC3-001; intron 4
ENST00000243938 ; WFDC3-007; intron 4
Database links

Mature sequence hsa-miR-3646

Accession MIMAT0018065
Sequence

58 - 

aaaaugaaaugagcccagccca

 - 79

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).