|
miRBase |
|
Stem-loop sequence vvi-MIR3629c |
|||||
| Accession | MI0016024 | ||||
| Description | Vitis vinifera miR3629c stem-loop | ||||
| Stem-loop |
g c a -u c ugaagcuugaggacauaaaaauagg ucu uuugg ugcugagaaa ug aggaaaag ga u ||| ||||| |||||||||| || |||||||| || u agg aaacc augacucuuu ac uccuuuuc cu g g a - uu - uucucccguugucggcagaguuugg |
||||
| Genome context |
|
||||
Mature sequence vvi-miR3629c |
|
| Accession | MIMAT0018024 |
| Sequence |
8 - ggcugcugagaaaauguagga - 28 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20230504
"Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis"
Plant J. 62:960-976(2010).
|