Stem-loop sequence hsa-mir-3622b

AccessionMI0016014 (change log)
Symbol HGNC:MIR3622B
DescriptionHomo sapiens miR-3622b stem-loop
Gene family MIPF0001179; mir-3622
Stem-loop
   agugaua                          g         cu   c 
5'        uaauagagggugcacaggcaugggag ucaggugag  cag u
          |||||||||||||||||||||||||| |||||||||  |||  
3'        guuaucucccacguguccgugcccuc aguccacuc  guc c
   ----ucg                          g         -c   c 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 14 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 27701673-27701767 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3622b
hsa-mir-3622achr8: 27701677-27701759 [+]
hsa-mir-3622bchr8: 27701673-27701767 [-]
Database links

Mature sequence hsa-miR-3622b-5p

Accession MIMAT0018005
Sequence

23 - 

aggcaugggaggucagguga

 - 42

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-3622b-3p

Accession MIMAT0018006
Sequence

58 - 

ucaccugagcucccgugccug

 - 78

Get sequence
Deep sequencing30 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1