Stem-loop sequence hsa-mir-23c

Accession MI0016010
Description Homo sapiens miR-23c stem-loop
Gene family MIPF0001429; mir-23c
Stem-loop 
a  g       --a    -    --a  --    -  ---     -aa     gu 
 gu acuuucc   ggug ucac   ca  guga gu   ggcau   ucaga  a
 || |||||||   |||| ||||   ||  |||| ||   |||||   |||||   
 ca ugaaagg   ccau agug   gu  cacu ca   ccgua   aguuu  c
g  g       aac    u    acc  ua    a  uac     cug     aa
Get sequence
Deep sequencing
21593 reads, 32 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 20035206-20035305 [-]
sense
OTTHUMT00000056002 ; MAP7D2-002; intron 5
OTTHUMT00000056002 ; MAP7D2-002; intron 5
OTTHUMT00000056002 ; MAP7D2-002; intron 5
OTTHUMT00000412035 ; MAP7D2-008; intron 8
OTTHUMT00000412035 ; MAP7D2-008; intron 8
OTTHUMT00000412035 ; MAP7D2-008; intron 8
OTTHUMT00000056001 ; MAP7D2-001; intron 9
OTTHUMT00000412037 ; MAP7D2-006; intron 9
OTTHUMT00000056001 ; MAP7D2-001; intron 9
OTTHUMT00000412037 ; MAP7D2-006; intron 9
OTTHUMT00000056001 ; MAP7D2-001; intron 9
OTTHUMT00000412037 ; MAP7D2-006; intron 9
OTTHUMT00000056003 ; MAP7D2-003; intron 10
OTTHUMT00000056003 ; MAP7D2-003; intron 10
OTTHUMT00000056003 ; MAP7D2-003; intron 10
ENST00000544957 ; MAP7D2-203; intron 4
ENST00000544957 ; MAP7D2-203; intron 4
ENST00000485173 ; MAP7D2-002; intron 5
ENST00000485173 ; MAP7D2-002; intron 5
ENST00000485173 ; MAP7D2-002; intron 5
ENST00000543767 ; MAP7D2-202; intron 7
ENST00000543767 ; MAP7D2-202; intron 7
ENST00000543767 ; MAP7D2-201; intron 7
ENST00000443379 ; MAP7D2-008; intron 8
ENST00000443379 ; MAP7D2-008; intron 8
ENST00000443379 ; MAP7D2-008; intron 8
ENST00000379651 ; MAP7D2-001; intron 9
ENST00000452324 ; MAP7D2-006; intron 9
ENST00000379651 ; MAP7D2-001; intron 9
ENST00000452324 ; MAP7D2-006; intron 9
ENST00000379651 ; MAP7D2-001; intron 9
ENST00000452324 ; MAP7D2-006; intron 9
ENST00000379643 ; MAP7D2-003; intron 10
ENST00000379643 ; MAP7D2-003; intron 10
ENST00000379643 ; MAP7D2-003; intron 10
Database links
  • ENTREZGENE: 100500809;MIR23C

Mature sequence hsa-miR-23c

Accession MIMAT0018000
Sequence

66 -  

aucacauugccagugauuaccc

 - 87

Get sequence
Deep sequencing 21593 reads, 32 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).