Stem-loop sequence hsa-mir-3619

Accession

MI0016009

Description

Homo sapiens miR-3619 stem-loop

Stem-loop

     -a       -a u           c    g ag   g 
acggc  ucuuugc  c cagcaggcagg uggu c  ccc u
|||||  |||||||  | ||||||||||| |||| |  ||| g
ugucg  aggaaug  g gucguccgucc acca g  ggg g
     gc       gg u           u    g --   u 

Deep sequencing

4 reads, 2 experiments

Genome context

• Coordinates (GRCh37.p5): chr22: 46486924-46487006 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000316781 ; RP4-695O20__B.10-001; intron 1

  OTTHUMT00000316782 ; RP4-695O20__B.10-002; intron 1

  OTTHUMT00000316783 ; RP4-695O20__B.10-003; intron 1

  OTTHUMT00000316787 ; RP4-695O20__B.10-007; intron 1

  OTTHUMT00000316781 ; RP4-695O20__B.10-001; intron 1

  OTTHUMT00000316782 ; RP4-695O20__B.10-002; intron 1

  OTTHUMT00000316783 ; RP4-695O20__B.10-003; intron 1

  OTTHUMT00000316787 ; RP4-695O20__B.10-007; intron 1

  OTTHUMT00000316781 ; RP4-695O20__B.10-001; intron 1

  OTTHUMT00000316782 ; RP4-695O20__B.10-002; intron 1

  OTTHUMT00000316783 ; RP4-695O20__B.10-003; intron 1

  OTTHUMT00000316787 ; RP4-695O20__B.10-007; intron 1

  ENST00000381051 ; MIRLET7BHG-003; intron 1

  ENST00000443490 ; MIRLET7BHG-007; intron 1

  ENST00000435439 ; MIRLET7BHG-002; intron 1

  ENST00000360737 ; MIRLET7BHG-001; intron 1

  ENST00000381051 ; RP4-695O20__B.10-003; intron 1

  ENST00000443490 ; RP4-695O20__B.10-007; intron 1

  ENST00000435439 ; RP4-695O20__B.10-002; intron 1

  ENST00000360737 ; RP4-695O20__B.10-001; intron 1

  ENST00000381051 ; hsa-mir-4763.1-003; intron 1

  ENST00000443490 ; hsa-mir-4763.1-007; intron 1

  ENST00000435439 ; hsa-mir-4763.1-002; intron 1

  ENST00000360737 ; hsa-mir-4763.1-001; intron 1

Database links

• ENTREZGENE: 100500828;MIR3619

Mature sequence hsa-miR-3619-5p

• Accession: MIMAT0017999
• Previous IDs: hsa-miR-3619
• Sequence: 16 - ucagcaggcaggcuggugcagc - 37
• Deep sequencing: 4 reads, 2 experiments
• Evidence: experimental; Solexa [1-2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3619-5p
  • MIRDB:hsa-miR-3619-5p
  • RNA22-HSA:hsa-miR-3619-5p
  • TARGETMINER:hsa-miR-3619-5p

Mature sequence hsa-miR-3619-3p

• Accession: MIMAT0019219
• Sequence: 47 - gggaccauccugccugcugugg - 68
• Evidence: experimental; Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3619-3p
  • MIRDB:hsa-miR-3619-3p
  • TARGETMINER:hsa-miR-3619-3p

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).