Stem-loop sequence hsa-mir-3616

Accession

MI0016006

Description

Homo sapiens miR-3616 stem-loop

Stem-loop

u    -       a              a   a         ugc 
 guca cuccgcc gcaucaugaagugc cuc ugauauguu   c
 |||| ||||||| |||||||||||||| ||| |||||||||   c
 cggu ggggcgg cguaguacuuuacg gag acugugcga   c
a    u       a              g   c         cua 

Deep sequencing

2 reads, 2 experiments

Genome context

• Coordinates (GRCh37.p5): chr20: 45795609-45795700 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000354590 ; EYA2-009; intron 8

  OTTHUMT00000354590 ; EYA2-009; intron 8

  OTTHUMT00000354590 ; EYA2-009; intron 8

  OTTHUMT00000080324 ; EYA2-003; intron 10

  OTTHUMT00000080326 ; EYA2-005; intron 10

  OTTHUMT00000354589 ; EYA2-008; intron 10

  OTTHUMT00000080324 ; EYA2-003; intron 10

  OTTHUMT00000080326 ; EYA2-005; intron 10

  OTTHUMT00000354589 ; EYA2-008; intron 10

  OTTHUMT00000080324 ; EYA2-003; intron 10

  OTTHUMT00000080326 ; EYA2-005; intron 10

  OTTHUMT00000354589 ; EYA2-008; intron 10

  ENST00000484200 ; EYA2-009; intron 8

  ENST00000317304 ; EYA2-201; intron 8

  ENST00000484200 ; EYA2-009; intron 8

  ENST00000317304 ; EYA2-201; intron 8

  ENST00000484200 ; EYA2-009; intron 8

  ENST00000317304 ; EYA2-201; intron 8

  ENST00000327619 ; EYA2-005; intron 10

  ENST00000357410 ; EYA2-008; intron 10

  ENST00000497062 ; EYA2-003; intron 10

  ENST00000327619 ; EYA2-005; intron 10

  ENST00000357410 ; EYA2-008; intron 10

  ENST00000497062 ; EYA2-003; intron 10

  ENST00000327619 ; EYA2-005; intron 10

  ENST00000357410 ; EYA2-008; intron 10

  ENST00000497062 ; EYA2-003; intron 10

Database links

• ENTREZGENE: 100500814;MIR3616

Mature sequence hsa-miR-3616-5p

• Accession: MIMAT0017995
• Sequence: 19 - augaagugcacucaugauaugu - 40
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3616-5p
  • MIRDB:hsa-miR-3616-5p
  • RNA22-HSA:hsa-miR-3616-5p
  • TARGETMINER:hsa-miR-3616-5p

Mature sequence hsa-miR-3616-3p

• Accession: MIMAT0017996
• Sequence: 60 - cgagggcauuucaugaugcaggc - 82
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3616-3p
  • MIRDB:hsa-miR-3616-3p
  • RNA22-HSA:hsa-miR-3616-3p
  • TARGETMINER:hsa-miR-3616-3p

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).