Stem-loop sequence hsa-mir-3615

AccessionMI0016005 (change log)
Symbol HGNC:MIR3615
DescriptionHomo sapiens miR-3615 stem-loop
Gene family MIPF0001540; mir-3615
Literature search

1 open access papers mention hsa-mir-3615
(1 sentences)

Stem-loop 
       c g  a    ca  c      c     g    uu  u u 
5' gacu u gg cgcu  ga gccgcg ggggc ggga  gg c g
   |||| | || ||||  || |||||| ||||| ||||  || |  
3' uugg a cc gcgg  cu cggcgc ccucg cucu  cc g u
       c g  g    cg  -      u     g    cu  u g
Get sequence
Deep sequencing
6399 reads, 11.4 reads per million, 140 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 74748613-74748699 [+]
sense
OTTHUMT00000451529 ; MFSD11-015; intron 1
OTTHUMT00000451528 ; MFSD11-014; intron 4
OTTHUMT00000451521 ; MFSD11-003; intron 6
OTTHUMT00000451526 ; MFSD11-012; intron 6
OTTHUMT00000451527 ; MFSD11-013; intron 6
OTTHUMT00000451516 ; MFSD11-002; intron 7
OTTHUMT00000451522 ; MFSD11-005; intron 8
OTTHUMT00000451524 ; MFSD11-006; intron 8
OTTHUMT00000451515 ; MFSD11-001; intron 9
ENST00000585958 ; MFSD11-015; intron 1
ENST00000585584 ; MFSD11-014; intron 4
ENST00000593181 ; MFSD11-003; intron 6
ENST00000588670 ; MFSD11-012; intron 6
ENST00000588768 ; MFSD11-013; intron 6
ENST00000355954 ; MFSD11-201; intron 6
ENST00000588460 ; MFSD11-002; intron 7
ENST00000336509 ; MFSD11-005; intron 8
ENST00000590514 ; MFSD11-006; intron 8
ENST00000586622 ; MFSD11-001; intron 9
Database links

Mature sequence hsa-miR-3615

Accession MIMAT0017994
Sequence

51 -  

ucucucggcuccucgcggcuc

 - 71

Get sequence
Deep sequencing6244 reads, 126 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).