Stem-loop sequence hsa-mir-3614

Accession MI0016004
Description Homo sapiens miR-3614 stem-loop
Stem-loop 
gguucuguc ug gc    u                  uuug 
         u  g  cacu ggaucugaaggcugcccc    c
         |  |  |||| ||||||||||||||||||     
         a  u  gugg ucuagacuuccgaugggg    u
ucauucuua gu uu    u                  ucuc
Get sequence
Deep sequencing
131 reads, 15 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 54968631-54968716 [-]
sense
OTTHUMT00000440610 ; TRIM25-008; exon 2
OTTHUMT00000440610 ; TRIM25-008; exon 2
OTTHUMT00000440609 ; TRIM25-001; 3'UTR (exon 9)
OTTHUMT00000440609 ; TRIM25-001; 3'UTR (exon 9)
ENST00000573108 ; TRIM25-008; exon 2
ENST00000573108 ; TRIM25-008; exon 2
ENST00000316881 ; TRIM25-201; 3'UTR (exon 9)
ENST00000316881 ; TRIM25-001; 3'UTR (exon 9)
ENST00000316881 ; TRIM25-001; 3'UTR (exon 9)
antisense
OTTHUMT00000440617 ; RP11-670E13.5-001; intron 1
OTTHUMT00000440617 ; RP11-670E13.5-001; intron 1
ENST00000574826 ; RP11-670E13.5-001; intron 1
ENST00000574826 ; RP11-670E13.5-001; intron 1
Database links

Mature sequence hsa-miR-3614-5p

Accession MIMAT0017992
Sequence

15 -  

ccacuuggaucugaaggcugccc

 - 37

Get sequence
Deep sequencing 104 reads, 13 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

Mature sequence hsa-miR-3614-3p

Accession MIMAT0017993
Sequence

53 -  

uagccuucagaucuugguguuuu

 - 75

Get sequence
Deep sequencing 27 reads, 9 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).