Stem-loop sequence hsa-mir-3613

Accession

MI0016003

Description

Homo sapiens miR-3613 stem-loop

Gene family

MIPF0001411; mir-3613

Stem-loop

u  uug   u    uu    ua               g ugc 
 gg   ggu ugga  guug  cuuuuuuuuuuguuc u   a
 ||   ||| ||||  ||||  ||||||||||||||| |   u
 cu   cca acuu  caac  gaaaaaaaaaacaag a   u
a  uca   c    cc    cc               g uuu 

Deep sequencing

reads, experiments

Genome context

• Coordinates (GRCh37.p5): chr13: 50570551-50570637 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000044949 ; TRIM13-002; intron 1

  OTTHUMT00000044949 ; TRIM13-002; intron 1

  OTTHUMT00000044949 ; TRIM13-002; intron 1

  ENST00000442421 ; TRIM13-002; intron 1

  ENST00000442421 ; TRIM13-002; intron 1

  ENST00000442421 ; TRIM13-002; intron 1

Database links

• ENTREZGENE: 100500908;MIR3613

Mature sequence hsa-miR-3613-5p

• Accession: MIMAT0017990
• Sequence: 16 - uguuguacuuuuuuuuuuguuc - 37
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3613-5p
  • MIRDB:hsa-miR-3613-5p
  • RNA22-HSA:hsa-miR-3613-5p
  • TARGETMINER:hsa-miR-3613-5p

Mature sequence hsa-miR-3613-3p

• Accession: MIMAT0017991
• Sequence: 53 - acaaaaaaaaaagcccaacccuuc - 76
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3613-3p
  • MIRDB:hsa-miR-3613-3p
  • RNA22-HSA:hsa-miR-3613-3p
  • TARGETMINER:hsa-miR-3613-3p

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).