Stem-loop sequence hsa-mir-3611

Accession

MI0016001

Description

Homo sapiens miR-3611 stem-loop

Stem-loop

      u   a            uu           augaa 
agcagg cua uaagaauuucuu  ucuucacaauu     a
|||||| ||| ||||||||||||  |||||||||||     g
ucguuu gau auucuuaaagaa  agaaguguuaa     a
      u   c            --           agaaa 

Deep sequencing

108 reads, 9 experiments

Genome context

• Coordinates (GRCh37.p5): chr10: 35368526-35368608 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000047537 ; CUL2-001; intron 1

  OTTHUMT00000047542 ; CUL2-006; intron 1

  OTTHUMT00000047543 ; CUL2-007; intron 1

  OTTHUMT00000047544 ; CUL2-008; intron 1

  OTTHUMT00000047537 ; CUL2-001; intron 1

  OTTHUMT00000047542 ; CUL2-006; intron 1

  OTTHUMT00000047543 ; CUL2-007; intron 1

  OTTHUMT00000047544 ; CUL2-008; intron 1

  OTTHUMT00000047537 ; CUL2-001; intron 1

  OTTHUMT00000047542 ; CUL2-006; intron 1

  OTTHUMT00000047543 ; CUL2-007; intron 1

  OTTHUMT00000047544 ; CUL2-008; intron 1

  OTTHUMT00000047538 ; CUL2-002; intron 2

  OTTHUMT00000047538 ; CUL2-002; intron 2

  OTTHUMT00000047538 ; CUL2-002; intron 2

  ENST00000374751 ; CUL2-001; intron 1

  ENST00000374749 ; CUL2-006; intron 1

  ENST00000374754 ; CUL2-007; intron 1

  ENST00000468804 ; CUL2-008; intron 1

  ENST00000374742 ; CUL2-201; intron 1

  ENST00000374751 ; CUL2-001; intron 1

  ENST00000374749 ; CUL2-006; intron 1

  ENST00000374754 ; CUL2-007; intron 1

  ENST00000468804 ; CUL2-008; intron 1

  ENST00000374742 ; CUL2-201; intron 1

  ENST00000374751 ; CUL2-001; intron 1

  ENST00000374749 ; CUL2-006; intron 1

  ENST00000374754 ; CUL2-007; intron 1

  ENST00000468804 ; CUL2-008; intron 1

  ENST00000374742 ; CUL2-201; intron 1

  ENST00000374748 ; CUL2-002; intron 2

  ENST00000374748 ; CUL2-002; intron 2

  ENST00000374748 ; CUL2-002; intron 2

Database links

• ENTREZGENE: 100500890;MIR3611

Mature sequence hsa-miR-3611

• Accession: MIMAT0017988
• Sequence: 52 - uugugaagaaagaaauucuua - 72
• Deep sequencing: 106 reads, 8 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3611
  • MIRDB:hsa-miR-3611
  • RNA22-HSA:hsa-miR-3611
  • TARGETMINER:hsa-miR-3611

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).