Stem-loop sequence hsa-mir-3610

Accession MI0016000
Description Homo sapiens miR-3610 stem-loop
Stem-loop 
aaga     g   uaa    a   a    guuug     g 
    gccgc gcg   cggc gcc ucuu     uuuga u
    ||||| |||   |||| ||| ||||     ||||| g
    cggcg ugu   gccg cgg agga     aggcu a
---g     g   -cg    -   -    ----a     a
Get sequence
Deep sequencing
11 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 117886967-117887039 [-]
sense
OTTHUMT00000381184 ; RAD21-001; 5'UTR (exon 1)
OTTHUMT00000381184 ; RAD21-001; 5'UTR (exon 1)
OTTHUMT00000381184 ; RAD21-001; 5'UTR (exon 1)
ENST00000297338 ; RAD21-001; 5'UTR (exon 1)
ENST00000297338 ; RAD21-001; 5'UTR (exon 1)
ENST00000297338 ; RAD21-001; 5'UTR (exon 1)
antisense
OTTHUMT00000381194 ; C8orf81-001; 3'UTR (exon 1)
OTTHUMT00000381194 ; C8orf81-001; 3'UTR (exon 1)
OTTHUMT00000381194 ; C8orf81-001; 3'UTR (exon 1)
ENST00000521487 ; NCRNA00255-001; 3'UTR (exon 1)
ENST00000521487 ; RAD21-AS1-001; 3'UTR (exon 1)
ENST00000521487 ; RAD21-AS1-001; 3'UTR (exon 1)
Database links

Mature sequence hsa-miR-3610

Accession MIMAT0017987
Sequence

42 -  

gaaucggaaaggaggcgccg

 - 61

Get sequence
Deep sequencing 11 reads, 9 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).