Stem-loop sequence hsa-mir-3609

Accession MI0015999
Description Homo sapiens miR-3609 stem-loop
Stem-loop 
--  aa    aacuu      -       ccu           
  gu  cagu     uuauuc ucauuuu   uuucucuacc 
  ||  ||||     |||||| |||||||   ||||||||| u
  cg  gucg     aaugag agugaaa   gaagagaugu 
cc  ag    gucau      u       --c
Get sequence
Deep sequencing
69 reads, 12 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 98479273-98479352 [+]
sense
OTTHUMT00000317981 ; TRRAP-004; intron 1
OTTHUMT00000317981 ; TRRAP-004; intron 1
OTTHUMT00000317981 ; TRRAP-004; intron 1
OTTHUMT00000317978 ; TRRAP-001; intron 2
OTTHUMT00000317979 ; TRRAP-002; intron 2
OTTHUMT00000317978 ; TRRAP-001; intron 2
OTTHUMT00000317979 ; TRRAP-002; intron 2
OTTHUMT00000317978 ; TRRAP-001; intron 2
OTTHUMT00000317979 ; TRRAP-002; intron 2
OTTHUMT00000317982 ; TRRAP-005; intron 3
OTTHUMT00000317982 ; TRRAP-005; intron 3
OTTHUMT00000317982 ; TRRAP-005; intron 3
ENST00000446306 ; TRRAP-004; intron 1
ENST00000446306 ; TRRAP-004; intron 1
ENST00000446306 ; TRRAP-004; intron 1
ENST00000359863 ; TRRAP-001; intron 2
ENST00000355540 ; TRRAP-002; intron 2
ENST00000359863 ; TRRAP-001; intron 2
ENST00000355540 ; TRRAP-002; intron 2
ENST00000359863 ; TRRAP-001; intron 2
ENST00000355540 ; TRRAP-002; intron 2
ENST00000417523 ; TRRAP-005; intron 3
ENST00000417523 ; TRRAP-005; intron 3
ENST00000417523 ; TRRAP-005; intron 3
Database links

Mature sequence hsa-miR-3609

Accession MIMAT0017986
Sequence

51 -  

caaagugaugaguaauacuggcug

 - 74

Get sequence
Deep sequencing 69 reads, 12 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).