Dead miRNA entry

miRNA accession:
MI0015997
miRNA ID:
hsa-mir-3607
Comment:
The mir-3607 locus overlaps with an annotated snoRNA, SNORD138 (PMID:24174566). On inspection, the pattern of conservation of the locus in vertebrates suggests the snoRNA annotation is more likely. The pattern of deep sequencing reads mapping to the locus in human is also not supportive of the microRNA annotation.

Previous miRNA entry

Stem-loop sequence hsa-mir-3607

AccessionMI0015997 (change log)
Symbol HGNC:MIR3607~withdrawn
DescriptionHomo sapiens miR-3607 stem-loop
Gene family MIPF0001566; mir-3607
Stem-loop
   aagguu cg      gu  ug    -aaau      ga   a 
5'       g  gugcau  ga  aagc     caguau  aug a
         |  ||||||  ||  ||||     ||||||  |||  
3'       c  caugua  cu  uucg     gucaua  uac u
   ---acu au      gu  --    caaau      -g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-3607-5p

Accession MIMAT0017984
Sequence

12 - 

gcaugugaugaagcaaaucagu

 - 33

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3607-3p

Accession MIMAT0017985
Sequence

51 - 

acuguaaacgcuuucugaug

 - 70

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1