Stem-loop sequence bfl-mir-135b-2

AccessionMI0015994 (change log)
DescriptionBranchiostoma floridae miR-135b-2 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   ccg            uu    cuu      -   cu 
5'    uguccaauggcu  cauc   ugugaa ugu  g
      ||||||||||||  ||||   |||||| |||   
3'    acagguuauugg  guag   acacuu aca  a
   aga            gg    -uc      g   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666574.1: 3848991-3849062 [-]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-135b-2
bfl-mir-135b-2GG666574.1: 3848991-3849062 [-]
bfl-mir-135a-2GG666574.1: 3848762-3848843 [-]
bfl-mir-135b-1GG666574.1: 3847619-3847690 [-]
bfl-mir-135a-1GG666574.1: 3847395-3847476 [-]
Database links

Mature sequence bfl-miR-135b

Accession MIMAT0010194
Sequence

9 - 

aauggcuuucauccuuuguga

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).