Stem-loop sequence mmu-mir-1906-2

AccessionMI0015984 (change log)
Symbol MGI:Mir1906-2
DescriptionMus musculus miR-1906-2 stem-loop
Gene family MIPF0001001; mir-1906
Literature search

2 open access papers mention mmu-mir-1906-2
(2 sentences)

Stem-loop
   ----------------------------------------------------g   a       c 
5'                                                      gac uuaggag a
                                                        ||| |||||||  
3'                                                      uug gauccuc a
   ccagagacgggucgggacggaguccgacgacgucaaguaaauuaagaguguug   g       c 
Get sequence
Deep sequencing
78 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 88759474-88759553 [-]
sense
OTTMUST00000113142 ; RP23-286G19.5-001; exon 1
ENSMUST00000182943 ; Gm27000-001; exon 1
antisense
OTTMUST00000113140 ; RP23-286G19.6-001; exon 1
ENSMUST00000182791 ; Gm26958-001; exon 1
Database links

Mature sequence mmu-miR-1906

Accession MIMAT0007872
Sequence

48 - 

ugcagcagccugaggcagggcu

 - 69

Get sequence
Deep sequencing20 reads, 9 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).