Stem-loop sequence hsa-mir-1244-3

AccessionMI0015975 (change log)
Symbol HGNC:MIR1244-3
DescriptionHomo sapiens miR-1244-3 stem-loop
Gene family MIPF0000569; mir-1244
Literature search

7 open access papers mention hsa-mir-1244-3
(17 sentences)

Stem-loop
   ---------       uccga   uu    ua   uuuuug    u    uu 
5'          aucuuau     gca  ccag  acu      ugua guac  a
            |||||||     |||  ||||  |||      |||| ||||   
3'          uagagua     ugu  gguu  uga      auau caug  g
   aaaaauugg       -----   uu    ga   ------    -    uc 
Get sequence
Deep sequencing
113 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 9239467-9239551 [-]
sense
OTTHUMT00000400121 ; A2M-012; intron 3
OTTHUMT00000400122 ; A2M-009; intron 3
OTTHUMT00000317240 ; A2M-006; intron 3
OTTHUMT00000317233 ; A2M-001; intron 22
ENST00000543436 ; A2M-012; intron 3
ENST00000545828 ; A2M-009; intron 3
ENST00000462568 ; A2M-006; intron 3
ENST00000318602 ; A2M-001; intron 22
Database links

Mature sequence hsa-miR-1244

Accession MIMAT0005896
Sequence

55 - 

aaguaguugguuuguaugagaugguu

 - 80

Get sequence
Deep sequencing208 reads, 29 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).