Stem-loop sequence hsa-mir-1244-2

Accession MI0015974
Symbol HGNC:MIR1244
Description Homo sapiens miR-1244-2 stem-loop
Gene family MIPF0000569; mir-1244
Stem-loop
---------       uccga   uu    ua   uuuuug    u    uu 
         aucuuau     gca  ccag  acu      ugua guac  a
         |||||||     |||  ||||  |||      |||| ||||   
         uagagua     ugu  gguu  uga      auau caug  g
aaaaauugg       -----   uu    ga   ------    -    uc 
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 12264886-12264970 [+]
sense
OTTHUMT00000355995 ; BCL2L14-002; intron 3
OTTHUMT00000355995 ; BCL2L14-002; intron 3
ENST00000298566 ; BCL2L14-002; intron 3
ENST00000298566 ; BCL2L14-002; intron 3
ENST00000396369 ; BCL2L14-202; intron 4
ENST00000396369 ; BCL2L14-202; intron 4
antisense
OTTHUMT00000371469 ; DTWD2-004; intron 1
OTTHUMT00000371167 ; DTWD2-001; intron 1
OTTHUMT00000371169 ; DTWD2-003; intron 1
OTTHUMT00000371168 ; DTWD2-002; intron 1
ENST00000304058 ; DTWD2-004; intron 1
ENST00000510708 ; DTWD2-001; intron 1
ENST00000506980 ; DTWD2-003; intron 1
ENST00000515439 ; DTWD2-002; intron 1
Database links

Mature sequence hsa-miR-1244

Accession MIMAT0005896
Sequence

55 - 

aaguaguugguuuguaugagaugguu

 - 80

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).