Stem-loop sequence hsa-mir-1233-2

AccessionMI0015973 (change log)
Symbol HGNC:MIR1233-2
DescriptionHomo sapiens miR-1233-2 stem-loop
Gene family MIPF0000578; mir-1233
Literature search

15 open access papers mention hsa-mir-1233-2
(58 sentences)

Stem-loop
   guga        c      acgg    ggga    ca     aug 
5'     gugggagg cagggc    cagg    gcug  gggcu   g
       |||||||| ||||||    ||||    ||||  |||||    
3'     cgcccucc gucccg    gucu    cgac  cccgg   g
   --ga        u      ---a    ---g    --     gga 
Get sequence
Deep sequencing
88 reads, 2.13 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 34528290-34528371 [-]
sense
OTTHUMT00000417989 ; SLC12A6-002; exon 22
OTTHUMT00000417996 ; SLC12A6-017; exon 22
OTTHUMT00000417990 ; SLC12A6-010; exon 23
OTTHUMT00000417994 ; SLC12A6-007; 3'UTR (exon 23)
OTTHUMT00000417997 ; SLC12A6-020; 3'UTR (exon 23)
OTTHUMT00000251603 ; SLC12A6-001; exon 23
OTTHUMT00000417991 ; SLC12A6-003; exon 24
OTTHUMT00000417992 ; SLC12A6-005; 3'UTR (exon 24)
OTTHUMT00000417993 ; SLC12A6-006; exon 24
OTTHUMT00000417995 ; SLC12A6-008; exon 24
OTTHUMT00000417998 ; SLC12A6-009; exon 24
OTTHUMT00000417999 ; SLC12A6-004; exon 24
ENST00000451844 ; SLC12A6-201; exon 21
ENST00000397707 ; SLC12A6-002; exon 22
ENST00000560164 ; SLC12A6-017; exon 22
ENST00000560611 ; SLC12A6-010; exon 23
ENST00000559664 ; SLC12A6-007; 3'UTR (exon 23)
ENST00000561080 ; SLC12A6-020; 3'UTR (exon 23)
ENST00000290209 ; SLC12A6-001; exon 23
ENST00000354181 ; SLC12A6-003; exon 24
ENST00000559523 ; SLC12A6-005; 3'UTR (exon 24)
ENST00000458406 ; SLC12A6-006; exon 24
ENST00000397702 ; SLC12A6-008; exon 24
ENST00000558667 ; SLC12A6-009; exon 24
ENST00000558589 ; SLC12A6-004; exon 24
Database links

Mature sequence hsa-miR-1233-5p

Accession MIMAT0022943
Sequence

4 - 

agugggaggccagggcacggca

 - 25

Get sequence
Deep sequencing48 reads, 19 experiments
Evidence experimental; meta-analysis [2]
Predicted targets

Mature sequence hsa-miR-1233-3p

Accession MIMAT0005588
Previous IDshsa-miR-1233
Sequence

63 - 

ugagcccuguccucccgcag

 - 82

Get sequence
Deep sequencing80 reads, 26 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).
2
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).