Stem-loop sequence bta-mir-3596

AccessionMI0015952 (change log)
DescriptionBos taurus miR-3596 stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention bta-mir-3596
(8 sentences)

Stem-loop
   cucga ga   c          auaguuaucuuccgaggggg 
5'      g  agg aguagguugu                    c
        |  ||| ||||||||||                    a
3'      c  ucc ucauccaaca                    a
   ----c ac   a          caccaaagucccaucacuac 
Get sequence
Deep sequencing
1749 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 117458609-117458691 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-3596
bta-mir-3596chr5: 117458609-117458691 [-]
bta-let-7bchr5: 117458606-117458686 [+]
bta-mir-2443chr5: 117458061-117458133 [+]
bta-let-7a-3chr5: 117457806-117457879 [+]
Database links

Mature sequence bta-miR-3596

Accession MIMAT0016940
Sequence

60 - 

aaccacacaaccuacuaccuca

 - 81

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).