Stem-loop sequence bta-mir-3604-2

AccessionMI0015951 (change log)
DescriptionBos taurus miR-3604-2 stem-loop
Gene family MIPF0001050; mir-3604
Literature search

1 open access papers mention bta-mir-3604-2
(1 sentences)

Stem-loop
   ca c   a   a   gc      -    acaau ug    
5'   g cua cca ugu  agacua cugu     u  gga 
     | ||| ||| |||  |||||| ||||     |  || g
3'   c gau ggu aca  ucugau gaca     a  ccu 
   gg a   g   c   aa      a    ----- gu    
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 99127781-99127853 [+]
sense
ENSBTAT00000032743 ; DNM1-201; intron 15
antisense
ENSBTAT00000042353 ; bta-mir-199b-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3604-2
bta-mir-199bchr11: 99127762-99127861 [-]
bta-mir-3604-2chr11: 99127781-99127853 [+]
bta-mir-3154chr11: 99127964-99128048 [-]
Database links

Mature sequence bta-miR-3604

Accession MIMAT0016939
Sequence

6 - 

uaaccaaugugcagacuacugu

 - 27

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).