Stem-loop sequence bta-mir-3604-1

AccessionMI0015950 (change log)
DescriptionBos taurus miR-3604-1 stem-loop
Gene family MIPF0001050; mir-3604
Literature search

1 open access papers mention bta-mir-3604-1
(1 sentences)

Stem-loop
      a   uaa   a   g         guacaca     ag 
5' ccc gcc   cca ugu cagacuacu       uucag  c
   ||| |||   ||| ||| |||||||||       |||||   
3' ggg cgg   ggu aca gucugaugg       aaguc  c
      -   uug   c   a         -----ac     cc 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 16580960-16581037 [+]
sense
ENSBTAT00000036123 ; DNM2-201; intron 13
antisense
ENSBTAT00000042269 ; bta-mir-3604-1-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3604-1
bta-mir-3604-1chr7: 16580960-16581037 [+]
bta-mir-199a-2chr7: 16580964-16581034 [-]
Database links

Mature sequence bta-miR-3604

Accession MIMAT0016939
Sequence

8 - 

uaaccaaugugcagacuacugu

 - 29

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).