Stem-loop sequence bta-mir-3601

AccessionMI0015947 (change log)
DescriptionBos taurus miR-3601 stem-loop
Literature search

1 open access papers mention bta-mir-3601
(1 sentences)

Stem-loop
     -     c    a uu    a  -      a  -   ac 
5' cc cagac uuuc g  auca uc ugucac ag ugc  a
   || ||||| |||| |  |||| || |||||| || |||   
3' gg gucug agag c  uagu ag acagug uc aug  g
     a     u    c cc    -  u      c  u   gu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18283115-18283192 [+]
antisense
ENSBTAT00000042403 ; bta-mir-542-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3601
bta-mir-450bchrX: 18281872-18281957 [-]
bta-mir-450a-1chrX: 18282042-18282123 [-]
bta-mir-450a-2chrX: 18282193-18282284 [-]
bta-mir-542chrX: 18283105-18283201 [-]
bta-mir-3601chrX: 18283115-18283192 [+]
bta-mir-503chrX: 18288067-18288149 [-]
bta-mir-424chrX: 18288411-18288506 [-]
Database links

Mature sequence bta-miR-3601

Accession MIMAT0016936
Sequence

45 - 

ucucgugacaugaugauccccga

 - 67

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).