Stem-loop sequence bta-mir-409b

AccessionMI0015946 (change log)
Previous IDsbta-mir-3581
DescriptionBos taurus miR-409b stem-loop
Gene family MIPF0000018; mir-154
Literature search

4 open access papers mention bta-mir-409b
(4 sentences)

Stem-loop
   u a   -  aaa       ca         a  -    g 
5'  g uac cg   agggguu  ccgagcaac uu cguc u
    | ||| ||   |||||||  ||||||||| || |||| c
3'  c aug gc   ucuccaa  ggcucguug aa guag c
   a c   c  ccc       ug         a  c    a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67881619-67881697 [-]
antisense
ENSBTAT00000042340 ; bta-mir-409b-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-409b
bta-mir-656chr21: 67883062-67883140 [+]
bta-mir-323bchr21: 67882753-67882832 [+]
bta-mir-410chr21: 67882238-67882318 [+]
bta-mir-369chr21: 67881914-67881982 [+]
bta-mir-412chr21: 67881761-67881850 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-134chr21: 67871630-67871702 [+]
Database links

Mature sequence bta-miR-409b

Accession MIMAT0016935
Previous IDsbta-miR-3581
Sequence

13 - 

gggguucaccgagcaacauuc

 - 33

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).