Stem-loop sequence bta-mir-148c

AccessionMI0015944 (change log)
DescriptionBos taurus miR-148c stem-loop
Gene family MIPF0001027; mir-2957
Literature search

16 open access papers mention bta-mir-148c
(27 sentences)

Stem-loop
   cg      a       c       --    ---   c 
5'   ggccca guucugu augcacu  gacu   gcu c
     |||||| ||||||| |||||||  ||||   |||  
3'   ccgggu caagaca uauguga  cuga   cga a
   gg      c       c       gg    gcc   g 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 39247037-39247107 [-]
antisense
ENSBTAT00000056479 ; COPZ2-201; intron 1
ENSBTAT00000050861 ; bta-mir-152-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-148c
bta-mir-148cchr19: 39247037-39247107 [-]
bta-mir-152chr19: 39247030-39247115 [+]
Database links

Mature sequence bta-miR-148c

Accession MIMAT0016933
Sequence

6 - 

ccaaguucugucaugcacuga

 - 26

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).