Stem-loop sequence bmo-mir-2733e-3

AccessionMI0015937 (change log)
DescriptionBombyx mori miR-2733e-3 stem-loop
Gene family MIPF0000766; mir-2733
Literature search

2 open access papers mention bmo-mir-2733e-3
(5 sentences)

Stem-loop
   uuugcuggacugucuauaaugucuuucaac            -   u    aa    uuc 
5'                               aauagcuauuac uuc ccag  gaca   a
                                 |||||||||||| ||| ||||  ||||   c
3'                               uuaucgauaaug aag gguc  cugu   a
   ---------------------uuaaaaccu            u   -    -a    cuu 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bmo-miR-2733e

Accession MIMAT0013617
Sequence

68 - 

ucacugggaauguaauagcuau

 - 89

Get sequence
Deep sequencing63 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).