Stem-loop sequence ssc-mir-1296

AccessionMI0015931 (change log)
DescriptionSus scrofa miR-1296 stem-loop
Gene family MIPF0000649; mir-1296
Literature search

3 open access papers mention ssc-mir-1296
(5 sentences)

Stem-loop
   --    a           c cu        cu   u     a 
5'   ccua cuggguuaggg c  ggcuccau  ccu uagga a
     |||| ||||||||||| |  ||||||||  ||| ||||| a
3'   gggu gacccaauccc g  uuggggug  ggg gucuu c
   uc    c           a uu        ag   u     c 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 72055628-72055712 [-]
intergenic
Database links

Mature sequence ssc-miR-1296-5p

Accession MIMAT0022964
Sequence

11 - 

uuagggcccuggcuccaucucc

 - 32

Get sequence
Deep sequencing89 reads, 12 experiments
Evidence experimental; Illumina [2]

Mature sequence ssc-miR-1296-3p

Accession MIMAT0017976
Previous IDsssc-miR-1296
Sequence

54 - 

gagugggguuuugacccuaacc

 - 75

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).