Stem-loop sequence ssc-mir-484

AccessionMI0015929 (change log)
DescriptionSus scrofa miR-484 stem-loop
Gene family MIPF0000219; mir-484
Literature search

2 open access papers mention ssc-mir-484
(2 sentences)

Stem-loop
   gca    ---uc   a  c  a       ccc  uaaac    a 
5'    gcca     guc gg uc guccccu   ga     cccu a
      ||||     ||| || || |||||||   ||     ||||  
3'    cggu     cgg cc ag cggggga   cu     ggga a
   -aa    uuuuu   a  c  -       -cc  -ucca    u 
Get sequence
Deep sequencing
182 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-484

Accession MIMAT0017974
Sequence

54 - 

cccagggggcgacccaggcu

 - 73

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).