Stem-loop sequence ssc-mir-383

AccessionMI0015927 (change log)
DescriptionSus scrofa miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   -cc     -c  a      aa    a        uug   aga 
5'    ugcuc  uc gaucag  ggug uuguggcu   ggu   u
      |||||  || ||||||  |||| ||||||||   |||    
3'    acgag  ag cugguc  ucac gacaccga   cua   a
   uga     aa  a      cg    -        ---   auu 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 2603744-2603825 [-]
intergenic
Database links

Mature sequence ssc-miR-383

Accession MIMAT0017972
Sequence

52 - 

ccacagcacugccuggucaga

 - 72

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).