Stem-loop sequence ssc-mir-146a

AccessionMI0015926 (change log)
DescriptionSus scrofa miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

25 open access papers mention ssc-mir-146a
(209 sentences)

Stem-loop
   ---ua       uu            c        g  uc 
5'      cucagcu  gagaacugaauu cauggguu ug  a
        |||||||  |||||||||||| |||||||| ||  u
3'      gggucga  uucuugauuuga guguccag ac  u
   cuaua       -c            a        -  ug 
Get sequence
Deep sequencing
5856 reads, 773 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr16: 68394520-68394597 [-]
sense
ENSSSCT00000018545 ; SLU7-201; intron 6
chr16: 68488129-68488206 [+]
sense
ENSSSCT00000018545 ; SLU7-201; intron 6
Database links

Mature sequence ssc-miR-146a-5p

Accession MIMAT0022963
Sequence

11 - 

ugagaacugaauuccauggguu

 - 32

Get sequence
Deep sequencing5853 reads, 15 experiments
Evidence experimental; Illumina [2]

Mature sequence ssc-miR-146a-3p

Accession MIMAT0017971
Previous IDsssc-miR-146a
Sequence

47 - 

ccugugaaguuuaguucuucag

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).