Stem-loop sequence ssc-mir-218-1

AccessionMI0015924 (change log)
Previous IDsssc-mir-218
DescriptionSus scrofa miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Literature search

6 open access papers mention ssc-mir-218-1
(31 sentences)

Stem-loop
   --a   u      u         cu        gg    -  g 
5'    gau uucugu gugcuugau  aaccaugu  uugc ca g
      ||| |||||| |||||||||  ||||||||  |||| ||  
3'    cug aaggua cacgaacug  uugguaca  aaug gu u
   gca   c      c         uc        -a    a  a 
Get sequence
Deep sequencing
581 reads, 41.7 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr8: 15443762-15443845 [-]
intergenic
Database links

Mature sequence ssc-miR-218-5p

Accession MIMAT0022961
Sequence

11 - 

uugugcuugaucuaaccaugu

 - 31

Get sequence
Deep sequencing581 reads, 12 experiments
Evidence experimental; Illumina [2]

Mature sequence ssc-miR-218-3p

Accession MIMAT0017969
Previous IDsssc-miR-218
Sequence

54 - 

augguucugucaagcaccaug

 - 74

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).