Stem-loop sequence ssc-mir-1271

AccessionMI0015922 (change log)
DescriptionSus scrofa miR-1271 stem-loop
Gene family MIPF0000483; mir-1271
Literature search

1 open access papers mention ssc-mir-1271
(1 sentences)

Stem-loop
   --   au             c     a          ua 
5'   uag  cagugcuuggcac uagua gcacucagua  u
     |||  ||||||||||||| ||||| ||||||||||   
3'   guc  guuacggaccgug aucgu cgugaguugu  a
   ga   gu             u     c          uc 
Get sequence
Deep sequencing
7847 reads, 1.32e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 83154226-83154303 [-]
sense
ENSSSCT00000027990 ; ARL10-201; intron 2
Database links

Mature sequence ssc-miR-1271-5p

Accession MIMAT0037381
Sequence

11 - 

cuuggcaccuaguaagcacuc

 - 31

Get sequence
Deep sequencing7834 reads, 15 experiments
Evidence experimental; Illumina [3]

Mature sequence ssc-miR-1271-3p

Accession MIMAT0017967
Sequence

49 - 

ugccugcuaugugccaggca

 - 68

Get sequence
Deep sequencing13 reads, 6 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
3
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).