Stem-loop sequence ssc-mir-1224

AccessionMI0015920 (change log)
DescriptionSus scrofa miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Literature search

3 open access papers mention ssc-mir-1224
(3 sentences)

Stem-loop
   ------  -    cuugg      cuc         a   --u   --    --c   g  c 
5'       cc uacc     ugagga   gggaggugg ggg   ggc  gcug   cag gc a
         || ||||     ||||||   ||||||||| |||   |||  ||||   ||| ||  
3'       gg gugg     acuccu   uccuccacc ccc   ucg  cgac   guc cg g
   gacguu  c    -----      cuc         c   ucu   cu    ucu   a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 131580811-131580918 [+]
sense
ENSSSCT00000027265 ; VWA5B2-201; 3'UTR (exon 21)
Database links

Mature sequence ssc-miR-1224

Accession MIMAT0017965
Sequence

79 - 

caccuccucucuccucaggu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).