Stem-loop sequence ssc-mir-376c

AccessionMI0015915 (change log)
DescriptionSus scrofa miR-376c stem-loop
Gene family MIPF0000091; mir-368
Literature search

3 open access papers mention ssc-mir-376c
(4 sentences)

Stem-loop
   --    u    g     ua     u         uguua 
5'   uauu aaaa gugga  uuccu cuauguuua     u
     |||| |||| |||||  ||||| |||||||||     u
3'   auga uuuu caccu  aagga gauacaaau     u
   cu    c    g     ua     -         uggug 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf2115: 32036-32113 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-376c
ssc-mir-376cchrUScaf2115: 32036-32113 [-]
ssc-mir-376achrUScaf2115: 30857-30936 [-]
ssc-mir-381chrUScaf2115: 27138-27219 [-]
Database links

Mature sequence ssc-miR-376c

Accession MIMAT0017960
Sequence

11 - 

guggauauuccuucuauguuua

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).