Stem-loop sequence ssc-mir-362

AccessionMI0015913 (change log)
DescriptionSus scrofa miR-362 stem-loop
Gene family MIPF0000209; mir-362
Literature search

5 open access papers mention ssc-mir-362
(8 sentences)

Stem-loop
   -ccc     -ca          acc        -a ug     
5'     ccucu   aauccuugga   uaggugug  g  cugc 
       |||||   ||||||||||   ||||||||  |  ||| u
3'     ggaga   uuaggaacuu   auccacac  c  gauc 
   aguc     aac          ---        aa gu     
Get sequence
Deep sequencing
1514 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 48638466-48638544 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-362
ssc-mir-532chrX: 48632025-48632104 [+]
ssc-mir-500chrX: 48637994-48638073 [+]
ssc-mir-362chrX: 48638466-48638544 [+]
ssc-mir-660chrX: 48640821-48640889 [+]
Database links

Mature sequence ssc-miR-362

Accession MIMAT0017958
Sequence

11 - 

aauccuuggaaccuaggugugagug

 - 35

Get sequence
Deep sequencing1007 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).