Stem-loop sequence ssc-mir-381

AccessionMI0015912 (change log)
DescriptionSus scrofa miR-381 stem-loop
Gene family MIPF0000018; mir-154
Literature search

3 open access papers mention ssc-mir-381
(5 sentences)

Stem-loop
   --         a  c   g   c    u        g g u 
5'   ugguacuua ag gag uug ccuu guauauuc g u u
     ||||||||| || ||| ||| |||| |||||||| | | u
3'   acuaugagu uc cuc aac ggaa cauauaag u g g
   aa         g  u   g   a    -        g g a 
Get sequence
Deep sequencing
483 reads, 40 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf2115: 27138-27219 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-381
ssc-mir-376cchrUScaf2115: 32036-32113 [-]
ssc-mir-376achrUScaf2115: 30857-30936 [-]
ssc-mir-381chrUScaf2115: 27138-27219 [-]
Database links

Mature sequence ssc-miR-381-5p

Accession MIMAT0017957
Sequence

11 - 

agcgagguugcccuuuguauauu

 - 33

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-381-3p

Accession MIMAT0037380
Sequence

51 - 

uauacaaggacaagcucucugu

 - 72

Get sequence
Deep sequencing482 reads, 15 experiments
Evidence experimental; Illumina [2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).