Stem-loop sequence ssc-mir-382

AccessionMI0015911 (change log)
DescriptionSus scrofa miR-382 stem-loop
Gene family MIPF0000018; mir-154
Literature search

3 open access papers mention ssc-mir-382
(3 sentences)

Stem-loop
   --ac         -a           ug      - uuu 
5'     uugaagaga  guuguucgugg  gauucg c   a
       |||||||||  |||||||||||  |||||| |   c
3'     gacuuuuuu  caacaggcacu  cuaagc g   u
   ccau         ca           ua      a uau 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-382

Accession MIMAT0017956
Sequence

11 - 

aaguuguucgugguggauucg

 - 31

Get sequence
Deep sequencing14 reads, 6 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).