Stem-loop sequence ssc-mir-4331-1

AccessionMI0015910 (change log)
DescriptionSus scrofa miR-4331-1 stem-loop
Literature search

2 open access papers mention ssc-mir-4331-1
(44 sentences)

Stem-loop
   -ccau     -a    g  g       a      ucagau 
5'      gagcu  uggc ua aucacag cacagc      c
        |||||  |||| || ||||||| ||||||       
3'      uucga  accg au ugguguc gugucg      u
   cucgu     cg    g  g       g      uuacgg 
Get sequence
Deep sequencing
133 reads, 2.22e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 60130099-60130178 [-]
intergenic
Database links

Mature sequence ssc-miR-4331-5p

Accession MIMAT0037379
Sequence

11 - 

uggcguagaucacagacacagc

 - 32

Get sequence
Deep sequencing96 reads, 12 experiments
Evidence experimental; Illumina [3]

Mature sequence ssc-miR-4331-3p

Accession MIMAT0017955
Sequence

49 - 

uguggcugugguguaggccagc

 - 70

Get sequence
Deep sequencing59 reads, 11 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
3
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).