Stem-loop sequence ssc-mir-133a-2

AccessionMI0015909 (change log)
DescriptionSus scrofa miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Literature search

40 open access papers mention ssc-mir-133a-2
(186 sentences)

Stem-loop
   ---------  g       aa  u  a        gccuc 
5'          ua agcuggu  aa gg accaaauc     u
            || |||||||  || || ||||||||      
3'          au ucgacca  uu cc ugguuuag     u
   uacguaucg  g       ac  c  c        guaac 
Get sequence
Deep sequencing
633 reads, 76.9 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 99485213-99485285 [+]
sense
ENSSSCT00000027846 ; ssc-mir-133a-2.1-201; exon 1
antisense
ENSSSCT00000025346 ; MIB1-201; intron 12
Database links

Mature sequence ssc-miR-133a-5p

Accession MIMAT0015299
Previous IDsssc-miR-133a*
Sequence

4 - 

agcugguaaaauggaaccaaau

 - 25

Get sequence
Deep sequencing30 reads, 9 experiments
Evidence experimental; cloned [3], Illumina [4]

Mature sequence ssc-miR-133a-3p

Accession MIMAT0010186
Previous IDsssc-miR-133a
Sequence

42 - 

uugguccccuucaaccagcug

 - 62

Get sequence
Deep sequencing1226 reads, 13 experiments
Evidence experimental; Illumina [5]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).