Stem-loop sequence ssc-mir-194b

AccessionMI0015905 (change log)
Previous IDsssc-mir-194
DescriptionSus scrofa miR-194b stem-loop
Gene family MIPF0000055; mir-194
Literature search

12 open access papers mention ssc-mir-194b
(33 sentences)

Stem-loop
   --    a    cu         a      g    cu  gc 
5'   cgcc ucag  guaacagcg cuccau ugga  gu  c
     |||| ||||  ||||||||| |||||| ||||  ||   
3'   gcgg aguu  cauugucgu gaggug accu  ua  c
   ca    c    uc         a      -    -u  ac 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 11786871-11786948 [-]
antisense
chr10: 11962863-11962940 [+]
antisense
Clustered miRNAs
< 10kb from ssc-mir-194b
ssc-mir-215chr10: 11963149-11963244 [+]
ssc-mir-194bchr10: 11962863-11962940 [+]
ssc-mir-194bchr10: 11786871-11786948 [-]
ssc-mir-215chr10: 11786567-11786662 [-]
Database links

Mature sequence ssc-miR-194b-5p

Accession MIMAT0020365
Previous IDsssc-miR-194-5p
Sequence

11 - 

uguaacagcgacuccaugugga

 - 32

Get sequence
Deep sequencing29 reads, 8 experiments
Evidence experimental; Illumina [2]

Mature sequence ssc-miR-194b-3p

Accession MIMAT0017951
Previous IDsssc-miR-194;ssc-miR-194-3p
Sequence

47 - 

ccaguggagaugcuguuaccuu

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).