Stem-loop sequence hsa-mir-500b

AccessionMI0015903 (change log)
Symbol HGNC:MIR500B
DescriptionHomo sapiens miR-500b stem-loop
Gene family MIPF0000139; mir-500
Literature search

28 open access papers mention hsa-mir-500b
(64 sentences)

Stem-loop
   -      cu -u         uac       ag g   uuu 
5'  cccccu  c  aauccuugc   cugggug  a ugc   c
    ||||||  |  |||||||||   |||||||  | |||   u
3'  ggggga  g  uuaggaacg   gacccac  u acg   g
   a      ac uc         ---       -g g   uaa 
Get sequence
Deep sequencing
15409 reads, 13.2 reads per million, 151 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 50010672-50010750 [+]
sense
OTTHUMT00000056562 ; CCNB3-005; intron 1
OTTHUMT00000056558 ; CCNB3-001; intron 1
OTTHUMT00000056559 ; CCNB3-002; intron 1
OTTHUMT00000056560 ; CCNB3-003; intron 1
OTTHUMT00000056561 ; CCNB3-004; intron 2
ENST00000491907 ; CCNB3-005; intron 1
ENST00000376042 ; CCNB3-001; intron 1
ENST00000376038 ; CCNB3-002; intron 1
ENST00000476167 ; CCNB3-003; intron 1
ENST00000493507 ; CCNB3-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-500b
hsa-mir-532chrX: 50003148-50003238 [+]
hsa-mir-188chrX: 50003503-50003588 [+]
hsa-mir-500achrX: 50008431-50008514 [+]
hsa-mir-362chrX: 50008964-50009028 [+]
hsa-mir-501chrX: 50009722-50009805 [+]
hsa-mir-500bchrX: 50010672-50010750 [+]
hsa-mir-660chrX: 50013241-50013337 [+]
hsa-mir-502chrX: 50014598-50014683 [+]
Database links

Mature sequence hsa-miR-500b-5p

Accession MIMAT0016925
Sequence

11 - 

aauccuugcuaccugggu

 - 28

Get sequence
Deep sequencing14652 reads, 149 experiments
Evidence experimental; SOLiD [1], Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-500b-3p

Accession MIMAT0027032
Sequence

51 - 

gcacccaggcaaggauucug

 - 70

Get sequence
Deep sequencing742 reads, 106 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).